View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557A_low_470 (Length: 204)

Name: NF11557A_low_470
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557A_low_470
NF11557A_low_470
[»] chr5 (1 HSPs)
chr5 (28-201)||(39185007-39185182)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 28 - 201
Target Start/End: Complemental strand, 39185182 - 39185007
Alignment:
28 gggttgtttaagtttttgtgttactgtttggtggtgtcgtcaccagctttccgacggccatacacggtgggtagtggtgctggttgcttggtt---tttt 124  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||    
39185182 gggttgtttaagtttttgtgttactgtttggtggtgttgtcaccagctttccgacggccatacacggtgggtagtggtgctggttgcttggttttttttt 39185083  T
125 ggcggttttgggtatatatcgacnnnnnnnctctgggtgtctcacatgctttcaggtttggtactggttttggtgat 201  Q
     | |||||| |||||||||||||       ||||||||||||||| |||||||| ||| ||||||||||||||||||    
39185082 tgtggttttaggtatatatcgac-ttttttctctgggtgtctcacgtgctttcacgttcggtactggttttggtgat 39185007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University