View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_470 (Length: 204)
Name: NF11557A_low_470
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_470 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 28 - 201
Target Start/End: Complemental strand, 39185182 - 39185007
Alignment:
| Q |
28 |
gggttgtttaagtttttgtgttactgtttggtggtgtcgtcaccagctttccgacggccatacacggtgggtagtggtgctggttgcttggtt---tttt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39185182 |
gggttgtttaagtttttgtgttactgtttggtggtgttgtcaccagctttccgacggccatacacggtgggtagtggtgctggttgcttggttttttttt |
39185083 |
T |
 |
| Q |
125 |
ggcggttttgggtatatatcgacnnnnnnnctctgggtgtctcacatgctttcaggtttggtactggttttggtgat |
201 |
Q |
| |
|
| |||||| ||||||||||||| ||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
39185082 |
tgtggttttaggtatatatcgac-ttttttctctgggtgtctcacgtgctttcacgttcggtactggttttggtgat |
39185007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University