View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_474 (Length: 202)
Name: NF11557A_low_474
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_474 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 20 - 155
Target Start/End: Complemental strand, 52491207 - 52491072
Alignment:
| Q |
20 |
tcttcttctttcaagcagccgtcacaagagccgcaaggttcatttcaccgccccaccaaacgttcgtcgtgtgttgattagcgcacctctctccggtgac |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52491207 |
tcttcttctttcaagcagctgtcacaagagccgcaaggttcatttcaccgccccatcaaacgtccgtcgtgtgttgattagcgcacctctctctggtgac |
52491108 |
T |
|
| Q |
120 |
cttcgttcaaagtacaatgtgtgttctcttcccgtt |
155 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |
|
|
| T |
52491107 |
cttcgttcaaagtacatcgtgcgttctcttcccgtt |
52491072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 28 - 155
Target Start/End: Original strand, 5404205 - 5404332
Alignment:
| Q |
28 |
tttcaagcagccgtcacaagagccgcaaggttcatttcaccgccccaccaaacgttcgtcgtgtgttgattagcgcacctctctccggtgaccttcgttc |
127 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| ||| ||| |||||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
5404205 |
tttcaagcagccgtcgcaagagccgcaaggctcatttcaccgccccatcaagcgtccgtcgtgtgttgatgagcgcacctctttccggtgacctccgttc |
5404304 |
T |
|
| Q |
128 |
aaagtacaatgtgtgttctcttcccgtt |
155 |
Q |
| |
|
||||||||| ||| |||||||||||||| |
|
|
| T |
5404305 |
aaagtacaacgtgcgttctcttcccgtt |
5404332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 20 - 97
Target Start/End: Original strand, 21946227 - 21946304
Alignment:
| Q |
20 |
tcttcttctttcaagcagccgtcacaagagccgcaaggttcatttcaccgccccaccaaacgttcgtcgtgtgttgat |
97 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
21946227 |
tcttcttctttcaagcatccgtcgcaagagccgcaaggttcattttaccgccacaccaaacgtccgtcgtgtgttgat |
21946304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 84 - 155
Target Start/End: Complemental strand, 30927147 - 30927076
Alignment:
| Q |
84 |
cgtcgtgtgttgattagcgcacctctctccggtgaccttcgttcaaagtacaatgtgtgttctcttcccgtt |
155 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
30927147 |
cgtcgtgtgttgatgagcgaacctctctccggtgaccttctttcaaagtacaacgtgcattctcttcccgtt |
30927076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University