View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_54 (Length: 380)
Name: NF11557A_low_54
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 360
Target Start/End: Original strand, 28390222 - 28390564
Alignment:
| Q |
18 |
aaacatagcctccaaattgaaattgtttagtaggccctaaacacattacaaaagcatgctagcttaccataatttccaatccaaacttgtctttaatttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28390222 |
aaacatagcctccaaattgaaattgtttagtaggccctaaacacattacaaaagcatgctagcttaccataatttccaatccaaacttgcctttaatttc |
28390321 |
T |
|
| Q |
118 |
tgttgatgaactcaaattaggtgaaat-catat-tcattctactctaaatatcgccctgttgcaaaagcagaggaaaatatgcattccataaaa-aatga |
214 |
Q |
| |
|
||||| |||||||||||||| ||| || ||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28390322 |
tgttggtgaactcaaattagctgagattcattcatcattctactctaaatattgccctgttgcaaaagcagagga---tatgcattccataaaaaaatga |
28390418 |
T |
|
| Q |
215 |
taatgatagcatttttatttatttataaagtttttcttactatgcataaatttcatctacagaggaggaatcaatagcctaaaatcaaaatcaatagtca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28390419 |
taatgatagcatttttatttatttataaagtttttcttactatgcataaatttcatctacagaggaggaatcaatagcctaaaatcaaaatcaatagtca |
28390518 |
T |
|
| Q |
315 |
agctgaatacacaagacaaacacaaggtgatactagctgacttttt |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28390519 |
agctgaatacacaagacaaacacaaggtgatactagctgacttttt |
28390564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 309 - 359
Target Start/End: Complemental strand, 28413492 - 28413442
Alignment:
| Q |
309 |
tagtcaagctgaatacacaagacaaacacaaggtgatactagctgactttt |
359 |
Q |
| |
|
||||||||||||||||| || ||||||| ||||||||||||||| ||||| |
|
|
| T |
28413492 |
tagtcaagctgaatacagaaaacaaacagcaggtgatactagctggctttt |
28413442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University