View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_87 (Length: 346)
Name: NF11557A_low_87
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_87 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 340
Target Start/End: Original strand, 8556144 - 8556483
Alignment:
| Q |
1 |
acacaacataatggttgaaaatggcgacataatccttccctcctttctctgtaatgtgaagtgagagtctctgaaagagaaatttggttcctattgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8556144 |
acacaacataatggttgaaaatggcgacataatccttccctcctttctctgtaatgtgaagtgagagtctctgaaagagaaatttggtccctattgaaag |
8556243 |
T |
|
| Q |
101 |
cgaaacaatgttgtcatttagtgtccattctcgccacattctttttcatttttcttcttgccgtagcagcatcagatacccaaactttcttcctcgttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556244 |
cgaaacaatgttgtcatttagtgtccattcccgccacattctttttcatttttcttcttaccgtagcagcatcagatacccaaactttcttcctcgttta |
8556343 |
T |
|
| Q |
201 |
tttaccaccaacacattattcaaatctcattactcttcttctcttaacaataacagctatagaagaaaaatgggttcactttctgtgtttgatgaaacca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556344 |
tttaccaccaacacattattcaaatctcattactcttcttctcttaacaataacagctatagaagaaaaatgggttcactttctgtgtttgatgaaacca |
8556443 |
T |
|
| Q |
301 |
tccaatatcccattgctcgcagaaacgactccgtcattga |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556444 |
tccaatatcccattgctcgcagaaacgactccgtcattga |
8556483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University