View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_96 (Length: 341)
Name: NF11557A_low_96
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_96 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 168 - 324
Target Start/End: Original strand, 48711209 - 48711369
Alignment:
| Q |
168 |
tatagtttctgttctgtttgtattttttggctctttcaatttctgtaacttccttttcctgcctggctcctatcgtta---tcgttatc-gttagcaggg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||| | |||||| |||||||||| |
|
|
| T |
48711209 |
tatagtttctgttctgtttgtattttttggctctttcaatttttgtaatttccttttcctgcttggctcctatcgttgctgtggttatcagttagcaggg |
48711308 |
T |
|
| Q |
264 |
gtctctttgtaacagcttgcctaattgcacatcttgtgctaggcttttctaatatattatg |
324 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48711309 |
gtctttttgtaacagcttgcctaattgcacatcttgtgctaggcttttctaatatattatg |
48711369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 27 - 139
Target Start/End: Original strand, 48710982 - 48711097
Alignment:
| Q |
27 |
aacctagaaaaatatggatttcttcaaatttaacacatcaaaataggatcatttggt---aacaacaacccataaacccagaaaaatagatttcgccaaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
48710982 |
aacctagaaaaatatggatttcttcaaatttaaaacatcaaaataggatcatttggtaacaacaacaacccataaaccgagaaaaatagatttcgccgaa |
48711081 |
T |
|
| Q |
124 |
ttcatctcttcaacaa |
139 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48711082 |
ttcatctcttcaacaa |
48711097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University