View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557_high_20 (Length: 241)
Name: NF11557_high_20
Description: NF11557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 39630168 - 39629950
Alignment:
| Q |
1 |
ttaaatttgtctcaaacccatacattgtcaattgttttaaatgctggctagcttcttcgagttccaacttctttgttgttggtgtttggtggtcttggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630168 |
ttaaatttgtctcaaacccatacattgtcaattgttttaaatgctggctagcttcttcgagttccaacttctttgttgttggtgtttggtggtcttggag |
39630069 |
T |
|
| Q |
101 |
aaataggaactcaagttgnnnnnnnaatgtttcgattccaacttaccatcttgccatggaagctcacaacttataacacactttcaacatttactttcca |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630068 |
aaataggaactcaagttgtttttttaatgtttcgatttcaacttaccat-----catggaagctcacaacttataacacactttcaacatttactttcca |
39629974 |
T |
|
| Q |
201 |
agatcaccagttcaccacccacat |
224 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
39629973 |
agatcactagttcaccacccacat |
39629950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University