View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557_high_6 (Length: 333)
Name: NF11557_high_6
Description: NF11557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557_high_6 |
 | |
|
| [»] scaffold1155 (1 HSPs) |
| | |
|
| [»] scaffold0345 (1 HSPs) |
| | |
|
| [»] scaffold0105 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 325
Target Start/End: Complemental strand, 29022062 - 29021738
Alignment:
| Q |
1 |
tctctatctccaactgtctcaaattctctctcactatatatgatccaacaccacctttcctttgtgacttattccctagattctccaacctcaactctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29022062 |
tctctatctccaactgtctcaaattctctctcactatatatgatccaacaccacctttcctttgtgacttattccctagattctccaacctcaactctct |
29021963 |
T |
|
| Q |
101 |
cgacctaaggtgctactatggtgacctcgactcgcttctctttcaaatctctcgcttccctttgaacctcacatctctcaatttctccgaccaagatatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29021962 |
cgacctaaggtgctactatggtgacctcgactcgcttctctttcaaatctctcgcttccctttgaacctcacatctctcaatttctccgaccaagatatc |
29021863 |
T |
|
| Q |
201 |
tttcccgcagatggtttgcgagctttcagtaaaaacattactactttgacctctctcacttgttaccaccttgaaaccctcaatagcactcatctcttct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29021862 |
tttcccgcagatggtttgcgagctttcagcaaaaacattactactttgacctctctcacttgttaccaccttgaaaccctcaatagcactcatctctttc |
29021763 |
T |
|
| Q |
301 |
tcattgctgattgcttccctttgct |
325 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
29021762 |
ttattgctgattgcttccctttgct |
29021738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 28660985 - 28661240
Alignment:
| Q |
1 |
tctctatctccaactgtctcaaattctctctcactatatatgatccaacaccacctttcctttgtgacttattccctagattctccaacctcaactctct |
100 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||| |||||||| |
|
|
| T |
28660985 |
tctctatcaccaacggtctcaaattctcgctcactatatatgatccaacaccacccttcctctgtagtctattccctagattctccaacctgaactctct |
28661084 |
T |
|
| Q |
101 |
cgacctaaggtgctactatggtgacctcgactcgcttctctttcaaatctctcgcttccctttgaacctcacatctctcaatttctccgaccaagatatc |
200 |
Q |
| |
|
|||||||| || ||||| ||| |||| ||||| ||||| |||||||||||| ||||||| ||||||||||||||||||||||||| | || || ||||| |
|
|
| T |
28661085 |
cgacctaacatgttactacggtaaccttgactcacttctatttcaaatctctagcttcccgttgaacctcacatctctcaatttctgcaacaaaaatatc |
28661184 |
T |
|
| Q |
201 |
tttcccgcagatggtttgcgagctttcagtaaaaacattactactttgacctctct |
256 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||| |||||||||||||| |
|
|
| T |
28661185 |
tttcccgcacatggtttgggagctttcagccaaaacattacaactttgacctctct |
28661240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 232 - 324
Target Start/End: Original strand, 28695545 - 28695637
Alignment:
| Q |
232 |
aaaacattactactttgacctctctcacttgttaccaccttgaaaccctcaatagcactcatctcttcttcattgctgattgcttccctttgc |
324 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| |||||||| ||| ||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28695545 |
aaaacattacaactatgacctctctcacttgttcccaccttgcaactctccatagcactgatctcttcttcattgctgattgcttccctttgc |
28695637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 325
Target Start/End: Original strand, 28673346 - 28673388
Alignment:
| Q |
283 |
atagcactcatctcttcttcattgctgattgcttccctttgct |
325 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28673346 |
atagcaccgatctcttcttcattgctgattgcttccctttgct |
28673388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 264
Target Start/End: Original strand, 21833269 - 21833331
Alignment:
| Q |
202 |
ttcccgcagatggtttgcgagctttcagtaaaaacattactactttgacctctctcacttgtt |
264 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21833269 |
ttcccgcagatgggttgcgagtttttgcacaaaacattactactttgacctctctcacttgtt |
21833331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 202 - 264
Target Start/End: Complemental strand, 553823 - 553761
Alignment:
| Q |
202 |
ttcccgcagatggtttgcgagctttcagtaaaaacattactactttgacctctctcacttgtt |
264 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
553823 |
ttcccgcaaatgggttgcgagctttctcccaaaacattacaactttgacctctctcacctgtt |
553761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 325
Target Start/End: Original strand, 2373556 - 2373589
Alignment:
| Q |
292 |
atctcttcttcattgctgattgcttccctttgct |
325 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
2373556 |
atctcttcttcattgctgattgtttccctttgct |
2373589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 264
Target Start/End: Original strand, 19467423 - 19467485
Alignment:
| Q |
202 |
ttcccgcagatggtttgcgagctttcagtaaaaacattactactttgacctctctcacttgtt |
264 |
Q |
| |
|
|||||||| |||| ||||||| ||||| | |||| ||||| |||||||||||||||||||||| |
|
|
| T |
19467423 |
ttcccgcaaatgggttgcgagttttcactcaaaatattacaactttgacctctctcacttgtt |
19467485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1155 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold1155
Description:
Target: scaffold1155; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 145 - 222
Target Start/End: Original strand, 1821 - 1898
Alignment:
| Q |
145 |
aaatctctcgcttccctttgaacctcacatctctcaatttctccgaccaagatatctttcccgcagatggtttgcgag |
222 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||| ||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
1821 |
aaatctctcgtttcccattgaacctcacatcactcaatctctcctaccaacccataattcccgcagatgggttgcgag |
1898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0345
Description:
Target: scaffold0345; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 145 - 222
Target Start/End: Complemental strand, 8395 - 8318
Alignment:
| Q |
145 |
aaatctctcgcttccctttgaacctcacatctctcaatttctccgaccaagatatctttcccgcagatggtttgcgag |
222 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||| ||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
8395 |
aaatctctcgtttcccattgaacctcacatcactcaatctctcctaccaacccataattcccgcagatgggttgcgag |
8318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 145 - 222
Target Start/End: Original strand, 30584 - 30661
Alignment:
| Q |
145 |
aaatctctcgcttccctttgaacctcacatctctcaatttctccgaccaagatatctttcccgcagatggtttgcgag |
222 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||| ||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
30584 |
aaatctctcgtttcccattgaacctcacatcactcaatctctcctaccaacccataattcccgcagatgggttgcgag |
30661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 325
Target Start/End: Complemental strand, 6432859 - 6432774
Alignment:
| Q |
240 |
actactttgacctctctcacttgttaccaccttgaaaccctcaatagcactcatctcttcttcattgctgattgcttccctttgct |
325 |
Q |
| |
|
||||||||||||||||||| ||||| |||| || | | || |||||| |||| ||||| ||||||| ||||| ||||||||||| |
|
|
| T |
6432859 |
actactttgacctctctcaattgttcccacattcattctcttaatagctctcacctcttactcattgccgattgtttccctttgct |
6432774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 264
Target Start/End: Complemental strand, 32152002 - 32151970
Alignment:
| Q |
232 |
aaaacattactactttgacctctctcacttgtt |
264 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
32152002 |
aaaacattacaactttgacctctctcacttgtt |
32151970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University