View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557_low_17 (Length: 241)
Name: NF11557_low_17
Description: NF11557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 26609618 - 26609392
Alignment:
| Q |
1 |
tttcaagaatgatttcttttcattggtcttagttggatcatacacgtttggcactcctccttttgttgctgaccttggctttaatgatcatatacagtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26609618 |
tttcaagaatgatttcttttcattggtcttagttggatcatacacgtttggcactcctccttttgttgctgaccttggctttaatgatcatatacagtta |
26609519 |
T |
|
| Q |
101 |
atttttatatatttcaaagtatcataatcattgttagcttattatatgacattcatcggattagacatgttcgggtgtcggacgcgtgtcatgttcaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
26609518 |
atttttatatatttcaaagtatcataatcattgttagcttgttatatgacattcatcggattagacatgttcggatgtcggacgcgtgtcgtgttcaaca |
26609419 |
T |
|
| Q |
201 |
gcgacacgacaccgacacaaatagttg |
227 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
26609418 |
gcgacacgataccgacacaaatagttg |
26609392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 156 - 218
Target Start/End: Complemental strand, 3209498 - 3209436
Alignment:
| Q |
156 |
tcggattagacatgttcgggtgtcggacgcgtgtcatgttcaacagcgacacgacaccgacac |
218 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
3209498 |
tcggattaggcgtgtccgggtgtcggacgcgtgtcgtgttcgacactgacacgacaccgacac |
3209436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University