View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557_low_18 (Length: 241)

Name: NF11557_low_18
Description: NF11557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557_low_18
NF11557_low_18
[»] chr1 (1 HSPs)
chr1 (18-241)||(43161891-43162114)


Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 43161891 - 43162114
Alignment:
18 agcatgtcagtcagaatatggttggatggcacttatatatacatcacatagtcctttcctgccccatttcaaccgatcaactaccaaagttggttcaagt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43161891 agcatgtcagtcagaatatggttggatggcacttatatatacatcacatagtcctttcctgccccatttcaaccgatcaactaccaaagttggttcaagt 43161990  T
118 gaggatgacatttcatgttgccattatctctttctgttttcatactagattcttcttttctgtcacatgttggcatattgcatgtttctccaaaaatcca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43161991 gaggatgacatttcatgttgccattatctctttctgttttcatactagattcttcttttctgtcacatgttggcatattgcatgtttctccaaaaatcca 43162090  T
218 agcaccacttccatctttatcact 241  Q
    ||||||||||||||||||||||||    
43162091 agcaccacttccatctttatcact 43162114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University