View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557_low_22 (Length: 231)

Name: NF11557_low_22
Description: NF11557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557_low_22
NF11557_low_22
[»] chr4 (2 HSPs)
chr4 (62-172)||(30684355-30684465)
chr4 (71-135)||(28485103-28485167)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 62 - 172
Target Start/End: Original strand, 30684355 - 30684465
Alignment:
62 ttcaacgtcagaatggaagtgattaaccaaaaggaggatgaagatcatccgagggcgatagaagacagcgacaacgccgtcgataccgactatggcacat 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
30684355 ttcaacgtcagaatggaagtgattaaccaaaaggaggatgaagatcatccgagggcgatagaagacagcgacaacgccgtcgataccgaatatggcacat 30684454  T
162 tgtacggtgcc 172  Q
    |||||||||||    
30684455 tgtacggtgcc 30684465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 71 - 135
Target Start/End: Original strand, 28485103 - 28485167
Alignment:
71 agaatggaagtgattaaccaaaaggaggatgaagatcatccgagggcgatagaagacagcgacaa 135  Q
    |||||||||| ||||||||| |||||||| || |||||||| |||||| ||||||||||||||||    
28485103 agaatggaagagattaaccagaaggaggaggaggatcatccaagggcggtagaagacagcgacaa 28485167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University