View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557_low_22 (Length: 231)
Name: NF11557_low_22
Description: NF11557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 62 - 172
Target Start/End: Original strand, 30684355 - 30684465
Alignment:
| Q |
62 |
ttcaacgtcagaatggaagtgattaaccaaaaggaggatgaagatcatccgagggcgatagaagacagcgacaacgccgtcgataccgactatggcacat |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30684355 |
ttcaacgtcagaatggaagtgattaaccaaaaggaggatgaagatcatccgagggcgatagaagacagcgacaacgccgtcgataccgaatatggcacat |
30684454 |
T |
 |
| Q |
162 |
tgtacggtgcc |
172 |
Q |
| |
|
||||||||||| |
|
|
| T |
30684455 |
tgtacggtgcc |
30684465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 71 - 135
Target Start/End: Original strand, 28485103 - 28485167
Alignment:
| Q |
71 |
agaatggaagtgattaaccaaaaggaggatgaagatcatccgagggcgatagaagacagcgacaa |
135 |
Q |
| |
|
|||||||||| ||||||||| |||||||| || |||||||| |||||| |||||||||||||||| |
|
|
| T |
28485103 |
agaatggaagagattaaccagaaggaggaggaggatcatccaagggcggtagaagacagcgacaa |
28485167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University