View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11558_high_22 (Length: 311)
Name: NF11558_high_22
Description: NF11558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11558_high_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 27701407 - 27701313
Alignment:
| Q |
1 |
cattttctcttttgctagttccaatgttatgtacattgtttttctttaatctcnnnnnnnattgacaattaatattctttaatcttggcatgtga |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27701407 |
cattttctcttttgctagttccaatgttatgtgcattgtttttctttaatctctttttttattgaaaattaatattctttaatcttggcatgtga |
27701313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 215 - 311
Target Start/End: Original strand, 47320254 - 47320351
Alignment:
| Q |
215 |
agtgcgaattctttcaactataca-tttacatcctgtacataatgcttgaatccgatggtattttcgtagcataactcatcttgaaatcttcgttctt |
311 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| || |||| | ||||||| |||||||||||| ||||| ||||||||||||||| |||| |||| |
|
|
| T |
47320254 |
agtgcgaattctttaaactatacactttacatcaagtgcatagagattgaatcagatggtattttcatagcacaactcatcttgaaattttcgatctt |
47320351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University