View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11558_low_26 (Length: 270)
Name: NF11558_low_26
Description: NF11558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11558_low_26 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 25 - 270
Target Start/End: Complemental strand, 40924928 - 40924686
Alignment:
| Q |
25 |
acgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatgcaggtaacaacaagtacatttctttgaggatgttcatcgccttttt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40924928 |
acgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatacaggtaacaacaagtacatttctttgaggatgttcatcgccttttt |
40924829 |
T |
|
| Q |
125 |
gaaactcatccgttctggagaagaattctgagacaagctgggaaggaccaagaacaaggcatgttgtcgtcaatgggaaactagctagctgttgctgatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40924828 |
gaaactcatccgttctggagaagaattctgagacaagctgggaaggaccaagaacaaggca---cgtcgtcaatgggaaactagctagctgttgctgatt |
40924732 |
T |
|
| Q |
225 |
gaaattggagggttttgaatgatacatggtcggaatgaagttttct |
270 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40924731 |
gaaattggcgggttttgaatgatatatggtcggaatgaagttttct |
40924686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University