View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11558_low_35 (Length: 236)
Name: NF11558_low_35
Description: NF11558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11558_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 10071890 - 10071951
Alignment:
| Q |
118 |
cattatgtgtgtgtggcaatcatcctctctttctttagctaaaaagaaaattaaaagaaaca |
179 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10071890 |
cattatgtgtgggtagcaatcatcctctctttctttagctaaaaagaaaattaaaagaaaca |
10071951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Original strand, 10071977 - 10072023
Alignment:
| Q |
173 |
agaaacaacaatgttctagttcttgtttggcatggtactaagcaaga |
219 |
Q |
| |
|
|||| ||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
10071977 |
agaatcaacaatgtgctagttcttgtctagcatggtactaagcaaga |
10072023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University