View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11559_high_7 (Length: 319)
Name: NF11559_high_7
Description: NF11559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11559_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 15 - 293
Target Start/End: Original strand, 3310950 - 3311228
Alignment:
| Q |
15 |
agagaggagaaatgagtgctgctgcttttgcagattgaactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa |
114 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310950 |
agagaggagaaatgagtgttgctgcttttgcagattgcactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa |
3311049 |
T |
 |
| Q |
115 |
tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311050 |
tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc |
3311149 |
T |
 |
| Q |
215 |
ccatttgtgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccctcattctaggatgtttaatgggt |
293 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3311150 |
ccacttgcgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccatcattctaggttgtttaatgggt |
3311228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University