View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11559_high_7 (Length: 319)

Name: NF11559_high_7
Description: NF11559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11559_high_7
NF11559_high_7
[»] chr1 (1 HSPs)
chr1 (15-293)||(3310950-3311228)


Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 15 - 293
Target Start/End: Original strand, 3310950 - 3311228
Alignment:
15 agagaggagaaatgagtgctgctgcttttgcagattgaactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa 114  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3310950 agagaggagaaatgagtgttgctgcttttgcagattgcactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa 3311049  T
115 tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3311050 tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc 3311149  T
215 ccatttgtgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccctcattctaggatgtttaatgggt 293  Q
    ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||    
3311150 ccacttgcgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccatcattctaggttgtttaatgggt 3311228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University