View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11559_low_11 (Length: 281)
Name: NF11559_low_11
Description: NF11559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11559_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 421678 - 421579
Alignment:
| Q |
17 |
agcatatcctgagtacagatcacccaccaattacccactgtctgcagaagccgcctcataagctgaatttccctcaaactcacacaaacttaactcaact |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421678 |
agcatatccagagtacagatcacccaccaattacccactgtctgcagaagccgcctcataagctgaatttccctcaaactcacacaaacttaactcaact |
421579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 183 - 258
Target Start/End: Complemental strand, 421511 - 421436
Alignment:
| Q |
183 |
gagatggagacaaaagtgttcagcttttttagggtgaaagtgagatcttttaagcgcacaacccatttagcatagc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421511 |
gagatggagacaaaagtgttcagcttttttagggtgaaagtgagatcttttaagcgcacaacccatttagcatagc |
421436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University