View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11559_low_8 (Length: 364)
Name: NF11559_low_8
Description: NF11559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11559_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 169 - 348
Target Start/End: Complemental strand, 32620931 - 32620752
Alignment:
| Q |
169 |
tggaagaaagcgctcaaaaagacgaagaaaagacaagacacacactaaaaacaagtgccacgcacattaggcgcgttgtcacgcgcccctgggggtgtgc |
268 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32620931 |
tggaagaaagcactcaaaaagacgaagaaaagacaagacacacactaaaaacaagtgccacgcacattaggcgcgtgacaacgcgcccctgggggtgtgc |
32620832 |
T |
 |
| Q |
269 |
aaaacaatgcataaaaacactatttttactcacacgtatggcgatcatcagaccacgcgcgaggcatttgcacctctgtg |
348 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
32620831 |
aaaacaatgcataaaaacattatttttactcacacgtatggcaatcaccagaccacgtgcgaggcatttgcgcctctgtg |
32620752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 41 - 167
Target Start/End: Complemental strand, 32627502 - 32627376
Alignment:
| Q |
41 |
tgaaatatcaacttttttggttgaatgaaatatttgtttttattgttacatttaattctatannnnnnnaaggacatttaatctacagtgtcacgtatcc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||| ||| | ||||||||||| |
|
|
| T |
32627502 |
tgaaatatcaacttttttggttgaatgaaatatttgttttttttgttacatttaattctatattttttcaagggcatttaacctatactgtcacgtatct |
32627403 |
T |
 |
| Q |
141 |
taagaaaatattcttacactgtcccgt |
167 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32627402 |
taagaaaatattcttacactgtcccgt |
32627376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 49680696 - 49680736
Alignment:
| Q |
57 |
ttggttgaatgaaatatttgtttttattgttacatttaatt |
97 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
49680696 |
ttggttggatgaaatatttgtttctattcttacatttaatt |
49680736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University