View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_high_12 (Length: 312)
Name: NF1155_high_12
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_high_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 90 - 312
Target Start/End: Original strand, 42984256 - 42984476
Alignment:
| Q |
90 |
aaaataatggactacattttcagggtaaaattagctatcaattgactcaatcaatatgnnnnnnnnnagaggaatagaaggaaggattatcatttaaaaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42984256 |
aaaataatggactacattttcagggtaaaattagctatcaattgactcaatcaatatgttttttt--agaggaatagaaggaaggattatcatttaaaaa |
42984353 |
T |
|
| Q |
190 |
tatctttgtttgtactacacatttagcatggtgtcaatttcaactttattttggagtgcatttatgtatatactccatccatgataaaatacgcgtgaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984354 |
tatctttgtttgtactacacatttagcatggtgtcactttcaactttattttggagtgcatttatgtatatactccatccatgataaaatacgcgtgaac |
42984453 |
T |
|
| Q |
290 |
tatttatgtgtaatagttatgtt |
312 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42984454 |
tatttatgtgtaatagttatgtt |
42984476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University