View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_high_14 (Length: 306)
Name: NF1155_high_14
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 97 - 281
Target Start/End: Original strand, 45616686 - 45616870
Alignment:
| Q |
97 |
ggtctaaggttatcacgttctaggaagtttttctctacaatgctcttttcaactagaattgtaagaatctacaatgatattgtgaacaaaattatgaaca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616686 |
ggtctaaggttatcacgttctaggaagtttttctctacaatgctctattcaactagaattgtaagaatctacaatgatattgtgaacaaaattatgaaca |
45616785 |
T |
 |
| Q |
197 |
tggaaaacagttatccagttattgttctacctactcaatggggtcttcctgttctgtctcacccctcagttgtttgcagaaggag |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45616786 |
tggaaaacagttatccagttattgttctacctactcaatggggtcttcctgttctgtctcatccctcagttgtttgcagaaggag |
45616870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University