View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_low_10 (Length: 396)
Name: NF1155_low_10
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 102 - 207
Target Start/End: Original strand, 11315985 - 11316090
Alignment:
| Q |
102 |
ataaatttattataattcatatgagaattgtcaatgggttgatttcttttatcttagggtggatgaatgctttctctctcagctcatcttgtagaatcct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11315985 |
ataaatttattataattcatatgagaattgtcaatggattgatttcttttatcttagggtggatgaatgctttctctctcagctcatcttgtagaatcct |
11316084 |
T |
|
| Q |
202 |
tgcaaa |
207 |
Q |
| |
|
|||||| |
|
|
| T |
11316085 |
tgcaaa |
11316090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 285 - 385
Target Start/End: Original strand, 11316168 - 11316268
Alignment:
| Q |
285 |
gtagtcagacctaaactcacatttaacaatgttgaatgatgatgttcataaaagaacacacctgacgttttgattggatttgaatgtcctagctggttca |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11316168 |
gtagtcagacctaaactcacatttaacaatgttgaatgatgatgttcataaaagaacacacctgacgttttgattggatttgaatgtcctagctggttca |
11316267 |
T |
|
| Q |
385 |
t |
385 |
Q |
| |
|
| |
|
|
| T |
11316268 |
t |
11316268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University