View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_low_12 (Length: 379)
Name: NF1155_low_12
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 34 - 361
Target Start/End: Original strand, 48214087 - 48214414
Alignment:
| Q |
34 |
gtctgaatgatttttcgatcgtcaagggtgaacatgaccgatctgtatgtatgttcattcaacctgaatctatgtaatttcattatctcatgttttatac |
133 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48214087 |
gtctgaatgatttttcgatcatcaagggtgaacatgaccaatctgtatgtatgttcattcaacctgaatcattgtaatttcattatctcatgttttatac |
48214186 |
T |
 |
| Q |
134 |
tcatatttcaaaaccttgtgtgtttatgcatgtttgatctatctatgtttacgctttatgggcaaacgcatgtgttctcaccatttaatactaaaaaagg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48214187 |
tcatatttcaaaaccttgtgtgtttatgcatgttcgatctatctatgtttacgctttatgggcaaacgcatgtgttctcaccatttaattctaaaaaagg |
48214286 |
T |
 |
| Q |
234 |
tttgtaatcttatacgtttatgttgattttgtgtttgagatctttatatgtgttaactataaaatatgtttcagtatgatgtaggaactaatcggctcct |
333 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48214287 |
tttgtaatcttatacgtttatggtgattttgtgtttgagatctttatgtgtgttaactataaaatatgtttcagtatgatgtaggaactaatcggctcct |
48214386 |
T |
 |
| Q |
334 |
aaccttcgatcagctcggtttgtaacct |
361 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
48214387 |
gatcttcgatcagctcggtttgtaacct |
48214414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University