View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1155_low_14 (Length: 355)

Name: NF1155_low_14
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1155_low_14
NF1155_low_14
[»] chr8 (1 HSPs)
chr8 (102-207)||(11315985-11316090)


Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 102 - 207
Target Start/End: Original strand, 11315985 - 11316090
Alignment:
102 ataaatttattataattcatatgagaattgtcaatgggttgatttcttttatcttagggtggatgaatgctttctctctcagctcatcttgtagaatcct 201  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11315985 ataaatttattataattcatatgagaattgtcaatggattgatttcttttatcttagggtggatgaatgctttctctctcagctcatcttgtagaatcct 11316084  T
202 tgcaaa 207  Q
    ||||||    
11316085 tgcaaa 11316090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University