View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_low_15 (Length: 355)
Name: NF1155_low_15
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 7 - 342
Target Start/End: Original strand, 8016262 - 8016597
Alignment:
| Q |
7 |
cattcaacttgagcaacttcaaaacagagaaacaaagcttcatgtcaacacacaatcttttcaccagcattaccaaaacgcttcgccttctcgagttatg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8016262 |
cattcaacttgagcaacttcaaaacagagaaacaaagcttcatgtcaacacacaatcttttcaccagcattaccaaaacgcttcgccttcttgagttatg |
8016361 |
T |
|
| Q |
107 |
cttagctctcctcttcctcttatggctcatcactcgtctccctttcttcctcagtatctcgtctgacttcctccgaagccctctcttcgtcttcgccctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016362 |
cttagctctcctcttcctcttatggctcctcactcgtctccctttcttcctcaatatctcgtctgacttcctccgaagccctctcttcgtcttcgccctc |
8016461 |
T |
|
| Q |
207 |
tccaacgctatcatcgccgccctcctcgttcggtctgacctcctctcctcctctttatccgccaattctgcagctccagtggatgaacagattaaggaca |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016462 |
tccaacgctatcatcgccgccctcctcgttcagtctgacctcctctcctcctcttcatccgccaattctgcagctccagtggatgaacagattaaggaca |
8016561 |
T |
|
| Q |
307 |
gttctaaggatgatatagattcatgctatgcaacag |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016562 |
gttctaaggatgatatagattcatgctatgcaacag |
8016597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 32733175 - 32733135
Alignment:
| Q |
186 |
cctctcttcgtcttcgccctctccaacgctatcatcgccgc |
226 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
32733175 |
cctctcttcatcttcgccgtctccaacgccatcatcgccgc |
32733135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University