View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_low_26 (Length: 300)
Name: NF1155_low_26
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 30 - 288
Target Start/End: Complemental strand, 6704336 - 6704075
Alignment:
| Q |
30 |
cttttatcattatctatattttcttttaaaaatatctaccacctctttcatatttgccatcttcctctnnnnnnn--tgtcattgatttctaaccaaatt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6704336 |
cttttatcattatctatattttcttttaaaaatatctaccacctctttcatattcgccatcttcctctaaaaaaaaatgtcattgatttctaaccaaatt |
6704237 |
T |
|
| Q |
128 |
acatgataggagatgttcttcctttcatcaattcttgaaacatctcagcacaaaaacaatacacaattcaatacactcttttatactatgtctaagcata |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6704236 |
acatgataggagatgttcttcctttcatcaattcttgaaacatctcagcacacaaacattacacaattcgatacactcttttatactatgtctaagcata |
6704137 |
T |
|
| Q |
228 |
catatatatgtgcatgttttagtcgaaagttaatgattt-aaagtacatatcaaactatatt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6704136 |
catatatatgtgcatgttttagtcgaaagttaatgatttaaaagtacatatcaaactatatt |
6704075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University