View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_low_29 (Length: 252)
Name: NF1155_low_29
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 43619196 - 43619370
Alignment:
| Q |
1 |
tttcccacttccctgttctttgtcaaggttagcccttgcttagctgctgggtgcaccatggtcgtcaaacctgctgagcaaacacctctatctgctttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43619196 |
tttcccacttccctgttctttgtcaaggttagcccttgcttagctgctgggtgcaccatggtcgtcaaacctgctgagcaaacacctctatctgctttgt |
43619295 |
T |
|
| Q |
101 |
tttatgctcatctagctaaattggtatgattcggtaaatcattaatttctacttagcatcttatatcacctatga |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43619296 |
tttatgctcatctagctaaattggtatgattcggtaaatcattaatttctacttagcatcttatatcacctatga |
43619370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 28 - 119
Target Start/End: Original strand, 43626601 - 43626692
Alignment:
| Q |
28 |
gttagcccttgcttagctgctgggtgcaccatggtcgtcaaacctgctgagcaaacacctctatctgctttgttttatgctcatctagctaa |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
43626601 |
gttagcccttccttagctgctgggtgcaccatggttctcaaacctgctgaacaaacacctctttctgctttgttttatgcccatctagctaa |
43626692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 70 - 119
Target Start/End: Complemental strand, 32408421 - 32408372
Alignment:
| Q |
70 |
cctgctgagcaaacacctctatctgctttgttttatgctcatctagctaa |
119 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
32408421 |
cctgctgaacaaacacctctctctgctttgttttatgctcatcttgctaa |
32408372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University