View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_low_30 (Length: 251)
Name: NF1155_low_30
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_low_30 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 106 - 251
Target Start/End: Complemental strand, 7059459 - 7059314
Alignment:
| Q |
106 |
gatctgatatcaatgcagctgaaaacgacccttcactagttgcaatcaatagacagcaagacttctcagaaaaccaagcaatgcaatccacaaccaccat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059459 |
gatctgatatcaatgcagctgaaaacgacccttcactagttgcaatcaatagacagcaagacttctcagaaaaccaagcaatgcaatccacaaccaccat |
7059360 |
T |
|
| Q |
206 |
aaacaccaccgtctctgaggtggtggttccaccctttgattcagac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059359 |
aaacaccaccgtctctgaggtggtggttccaccctttgattcagac |
7059314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University