View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1155_low_36 (Length: 212)
Name: NF1155_low_36
Description: NF1155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1155_low_36 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 85 - 212
Target Start/End: Complemental strand, 42950431 - 42950304
Alignment:
| Q |
85 |
atatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaagata |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950431 |
atatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaagata |
42950332 |
T |
|
| Q |
185 |
acagtgttcgaatgctaggaaaagggaa |
212 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
42950331 |
acagtgttcgaatgctaggaaaatggaa |
42950304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University