View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11560_low_8 (Length: 298)
Name: NF11560_low_8
Description: NF11560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11560_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 30 - 285
Target Start/End: Original strand, 16309812 - 16310061
Alignment:
| Q |
30 |
atcgacgtttgaacacatgcatgtgtaaaataatactccctcgtgtatatgtgttttgatatgagtatgagtattgacgtggcaatatattaccggatac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16309812 |
atcgacgtttgaacacatgcatgtgtaaaataatactccctcgtgtatatgtgttttgatatg------agtattgacgtggcaatatattaccggatac |
16309905 |
T |
 |
| Q |
130 |
atgtataaaaaataattgtattaattaattaaatatgcgtcacaatatacatacatttggaatgatattgaggtcattagaaaagttttagaagagtccc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16309906 |
atgtataaaaaataattgtattaattaattaaatatgcgtcacaatatacatacatttggaatgatattgaggtcattagaaaagttttagaagagtccc |
16310005 |
T |
 |
| Q |
230 |
cgtgagcatattggtagagacatgcattgttatttgcaggattcgggtttgaacct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
16310006 |
cgtgagcatattggtagagacatgcattgttatttgcaggatttggatttgaacct |
16310061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 10602005 - 10602049
Alignment:
| Q |
225 |
gtccccgtgagcatattggtagagacatgcattgttatttgcagg |
269 |
Q |
| |
|
||||| |||||||| |||| |||||||||||||||||| |||||| |
|
|
| T |
10602005 |
gtccctgtgagcatgttggcagagacatgcattgttatatgcagg |
10602049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University