View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11561_high_20 (Length: 240)
Name: NF11561_high_20
Description: NF11561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11561_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 44105195 - 44105403
Alignment:
| Q |
14 |
cacagacacgagttaaggaaggtaagaattgaactttcatattgaaatgacaaaattattgattattaacttgaaattgtatacatgatttttaacatcg |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44105195 |
cacagacacgagttaaggaaggtaaaaatcgaactttcatatcgaaatgacaaaattattgattattaacttgaaatagtatacatgatttttaacatcg |
44105294 |
T |
 |
| Q |
114 |
aattgtgtccaatttaatttaaattttattagagtaacaacattatttatcaaaaagtgattgattatctttgcctttggaacaatgacgcaactaatga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44105295 |
aattgtgtccaatttaatttaaattttattagagtaaaaacattatttatcaaaaagtgatcgattatctttgcctttggaacaatgacgcaactaatga |
44105394 |
T |
 |
| Q |
214 |
agtaaaata |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
44105395 |
agtaaaata |
44105403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University