View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11561_high_23 (Length: 206)
Name: NF11561_high_23
Description: NF11561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11561_high_23 |
 |  |
|
| [»] scaffold1339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0093 (2 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1339 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold1339
Description:
Target: scaffold1339; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 1965 - 1918
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
1918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 46888525 - 46888475
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatctct |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46888525 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatctct |
46888475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 16302682 - 16302635
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16302682 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
16302635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 37987178 - 37987225
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37987178 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
37987225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 46915020 - 46914973
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46915020 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
46914973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 46915732 - 46915779
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46915732 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
46915779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 46889272 - 46889317
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46889272 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
46889317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 16854649 - 16854696
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
16854649 |
atttggtgtcaaactaattttgacaccatgatgtcatttgatcctatc |
16854696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37986463 - 37986416
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
37986463 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcttatc |
37986416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 50802595 - 50802642
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
50802595 |
atttggtgtcaaactaattttgacaccatggtgtcaattgatcctatc |
50802642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 50873282 - 50873235
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
50873282 |
atttggtgtcaaactaattttgacaccatggtgtcaattgatcctatc |
50873235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 13644127 - 13644173
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctat |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
13644127 |
atttggtgtcaaactaattttgacaccatggtatcatttgatcctat |
13644173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 16303395 - 16303440
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
16303395 |
atttggtgtcaaactaattttgacaccatgatgtcatttgatccta |
16303440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 171
Target Start/End: Complemental strand, 27545411 - 27545344
Alignment:
| Q |
104 |
cacacatattcaaatgagcttatgcataccgttcgagaaatatacatatacaaggctggatatcttaa |
171 |
Q |
| |
|
|||| |||||||||| | ||||||||||| ||| |||||||||||||| ||| ||||||||| ||||| |
|
|
| T |
27545411 |
cacatatattcaaataatcttatgcatacagtttgagaaatatacatagacacggctggataccttaa |
27545344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Complemental strand, 50801878 - 50801835
Alignment:
| Q |
5 |
ggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
50801878 |
ggtgtcaaactaattttgacaccatggtgtcatttgatcatatc |
50801835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 48
Target Start/End: Original strand, 50874002 - 50874045
Alignment:
| Q |
5 |
ggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
50874002 |
ggtgtcaaactaattttgacaccatggtgtcatttgatcatatc |
50874045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 53948709 - 53948662
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
53948709 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
53948662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 43400775 - 43400821
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctat |
47 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| |||||||||||| |
|
|
| T |
43400775 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctat |
43400821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0093 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0093
Description:
Target: scaffold0093; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 22774 - 22823
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatctc |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22774 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatctc |
22823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0093; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 22004 - 21957
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
22004 |
atttggtgtcaaactaattttgacaccatggtatcatttgatcctatc |
21957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 20)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 146 - 190
Target Start/End: Original strand, 56341033 - 56341077
Alignment:
| Q |
146 |
tacatatacaaggctggatatcttaacagtggtgacgcaacaaca |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56341033 |
tacatatacaaggctggatatcttaacagtggtgacgcaacaaca |
56341077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 6784890 - 6784843
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6784890 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
6784843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 19550232 - 19550279
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19550232 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
19550279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 36855672 - 36855719
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36855672 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
36855719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 42419034 - 42418987
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42419034 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
42418987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42419716 - 42419763
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42419716 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
42419763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 12835182 - 12835227
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12835182 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
12835227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 19549511 - 19549466
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19549511 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
19549466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 25478125 - 25478080
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25478125 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
25478080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 50696932 - 50696977
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50696932 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
50696977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 12834468 - 12834421
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
12834468 |
atttggtgtcaaactaattttgacaccatagtgtcatttgatcctatc |
12834421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 36854958 - 36854912
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctat |
47 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36854958 |
atttgatgtcaaactaattttgacaccatggtgtcatttgatcctat |
36854912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 18032806 - 18032761
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18032806 |
atttcgtgtcaaactaattttgacaccatggtgtcatttgatccta |
18032761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 50696233 - 50696186
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
50696233 |
atttagtgtcaaactaattttgacaccaaggtgtcatttgatcctatc |
50696186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 25236437 - 25236392
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
25236437 |
atttagtgtcaaactaattttgacaccatgatgtcatttgatccta |
25236392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 21825154 - 21825201
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
21825154 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
21825201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 13767729 - 13767775
Alignment:
| Q |
2 |
tttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||||| || ||| ||||||||||||| |
|
|
| T |
13767729 |
tttggtgtcaaactaattttgacactatattgtcatttgatcctatc |
13767775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 2 - 43
Target Start/End: Complemental strand, 13767538 - 13767497
Alignment:
| Q |
2 |
tttggtgtcaaactaattttgacaccatggtgttatttgatc |
43 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
13767538 |
tttggtgtcaaattaattttgacaccatggtgtcttttgatc |
13767497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 25478804 - 25478849
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||||||||||||||||||||||| |||| | | ||||||||||| |
|
|
| T |
25478804 |
atttggtgtcaaactaattttgacaacatgatatcatttgatccta |
25478849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 29004353 - 29004394
Alignment:
| Q |
9 |
tcaaactaattttgacaccatggtgttatttgatcctatctc |
50 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
29004353 |
tcaaactaattttgacatcatggtgtcatttgattctatctc |
29004394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 8460 - 8413
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8460 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
8413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 14)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3583648 - 3583695
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3583648 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
3583695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 16846862 - 16846815
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16846862 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
16846815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 16847679 - 16847726
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16847679 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
16847726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 29267993 - 29267946
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29267993 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
29267946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 3 - 48
Target Start/End: Complemental strand, 20054316 - 20054271
Alignment:
| Q |
3 |
ttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20054316 |
ttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
20054271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3583297 - 3583344
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
3583297 |
atttggtgtcaaattaattttgacaccatggtgtcatttgatcctatc |
3583344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 34654251 - 34654204
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34654251 |
atttgctgtcaaactaattttgacaccatggtgtcatttgatcctatc |
34654204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 24023028 - 24023073
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24023028 |
atttgttgtcaaactaattttgacaccatggtgtcatttgatccta |
24023073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3582481 - 3582434
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
3582481 |
atttggtgtcaaactaattttgacaccatgatgtcatttgatcatatc |
3582434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 46
Target Start/End: Original strand, 41273797 - 41273836
Alignment:
| Q |
7 |
tgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41273797 |
tgtcaaactaattttgacaccatggtgtcatttgatccta |
41273836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 29268821 - 29268871
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatctct |
51 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
29268821 |
atttgatgtcaaattaattttgacaccatggtgtcatttgatcatatctct |
29268871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 41273014 - 41272969
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41273014 |
atttgatgtcaaactaattttaacaccatggtgtcatttgatccta |
41272969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 11 - 48
Target Start/End: Original strand, 20054999 - 20055036
Alignment:
| Q |
11 |
aaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
20054999 |
aaactaattttgacaccatggtgtcatttgatcatatc |
20055036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14754221 - 14754176
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||| |||| |
|
|
| T |
14754221 |
atttggtgtcaaactaattttgacacca--gtgtcatttgatcatatc |
14754176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24306398 - 24306351
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24306398 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
24306351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30471012 - 30471059
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30471012 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
30471059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 32021271 - 32021224
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32021271 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
32021224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42489978 - 42490025
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42489978 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
42490025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 30468742 - 30468697
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30468742 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
30468697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30001852 - 30001805
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
30001852 |
atttggtgtcaaactaattttgacaccatagtgtcatttgatcctatc |
30001805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 30469444 - 30469491
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30469444 |
atttgatgtcaaactaattttgacaccatggtgtcatttgatcctatc |
30469491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32022668 - 32022715
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
32022668 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcatatc |
32022715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 36784520 - 36784567
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
36784520 |
atttggtgtcaaactaattttgacaccatggtatcatttgatcctatc |
36784567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 42489263 - 42489216
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
42489263 |
atttggtgtcaaactaattttgacaccatggtgtcatttgattctatc |
42489216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 30002564 - 30002609
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30002564 |
atttgatgtcaaactaattttgacaccatggtgtcatttgatccta |
30002609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 36783808 - 36783763
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
36783808 |
atttggtgtcaaactaattttgacaccatggtatcatttgatccta |
36783763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37706328 - 37706373
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
37706328 |
atttggtgtcaaactaattttgacaccatagtgtcatttgatccta |
37706373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24307113 - 24307160
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
24307113 |
atttgatgtcaaactaattttgacatcatggtgtcatttgatcctatc |
24307160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 30470162 - 30470129
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30470162 |
atttggtgtcaaactaattttgacaccatggtgt |
30470129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 3163504 - 3163551
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
3163504 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
3163551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30659904 - 30659857
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
30659904 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
30659857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 46428125 - 46428172
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
46428125 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
46428172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 1370208 - 1370161
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1370208 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
1370161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1371059 - 1371106
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1371059 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
1371106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 18969160 - 18969113
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18969160 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
18969113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 24063784 - 24063829
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24063784 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
24063829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 18969856 - 18969903
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18969856 |
atttagtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
18969903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 5114252 - 5114213
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5114252 |
atttggtgtcaaactaattttgacaccatggtgtcatttg |
5114213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 32907476 - 32907429
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
32907476 |
atttggtgtcaaattaaatttgacaccatggtgtcatttgatcctatc |
32907429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 34713364 - 34713405
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgat |
42 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34713364 |
atttgatgtcaaactaattttgacaccatggtgtcatttgat |
34713405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 18649905 - 18649952
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
18649905 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
18649952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 22)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 492142 - 492189
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
492142 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
492189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 3259121 - 3259074
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3259121 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
3259074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 9917778 - 9917731
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9917778 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
9917731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 14481466 - 14481513
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14481466 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
14481513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 15915821 - 15915868
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15915821 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
15915868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 3259814 - 3259859
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3259814 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
3259859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 36038591 - 36038636
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36038591 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
36038636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10394870 - 10394917
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
10394870 |
atttggtgtcaaactaattttgacaccatggtgtcattttatcctatc |
10394917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14480798 - 14480751
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
14480798 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcatatc |
14480751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 9918492 - 9918534
Alignment:
| Q |
4 |
tggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9918492 |
tggtgtcaaactaattttgacaccatggtgtcatttgatccta |
9918534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 12281156 - 12281114
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatc |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12281156 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatc |
12281114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 25835903 - 25835861
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatc |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25835903 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatc |
25835861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 4737809 - 4737854
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
4737809 |
atttggtgtcaaactaattttgacatcatggtgtcatttgatccta |
4737854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 25836616 - 25836661
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
25836616 |
atttggtgtcaaaataattttgacaccatggtgtcatttgatccta |
25836661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10394154 - 10394107
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
10394154 |
atttggtgtcaaattaattttgacaccatggtgtcatttgatcttatc |
10394107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 15883215 - 15883170
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
15883215 |
atttgatgtcaaactaattttgacaccatgatgtcatttgatccta |
15883170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 15915133 - 15915088
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
15915133 |
atttggtgtcaaattaattttgacaccatgatgtcatttgatccta |
15915088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4737094 - 4737047
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
4737094 |
atttgatgtcaaacttattttgacaccatggtgtcatttgatcttatc |
4737047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 12281869 - 12281900
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggt |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12281869 |
atttggtgtcaaactaattttgacaccatggt |
12281900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 42520438 - 42520485
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | ||||||||| |||||||||||||||||||| |
|
|
| T |
42520438 |
atttggtgtcaaatttaatttgacaccttggtgttatttgatcctatc |
42520485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 490964 - 490915
Alignment:
| Q |
1 |
atttggtgtcaaactaattttg--acaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
490964 |
atttggtgtcaaactaattttgacacaccatggtgtcatttgatcatatc |
490915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 21148104 - 21148153
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatctc |
50 |
Q |
| |
|
||||||||||||| | | ||||||||| |||||| ||||||||||||||| |
|
|
| T |
21148104 |
atttggtgtcaaatttaatttgacaccttggtgtcatttgatcctatctc |
21148153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 22)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 863255 - 863208
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
863255 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
863208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 863968 - 864015
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
863968 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
864015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 8043806 - 8043853
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8043806 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
8043853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 34453012 - 34453059
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34453012 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
34453059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 36151103 - 36151153
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatctct |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
36151103 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctaactct |
36151153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 34452299 - 34452254
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34452299 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
34452254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 36150385 - 36150340
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36150385 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
36150340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 37876155 - 37876200
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37876155 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
37876200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 2054404 - 2054357
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2054404 |
atttagtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
2054357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 2055087 - 2055134
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2055087 |
attttgtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
2055134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24429667 - 24429620
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
24429667 |
atttggtgtcaaactaattttgacacgatggtgtcatttgatcctatc |
24429620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24433374 - 24433421
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
24433374 |
atttggtgtcaaactaattttgacatcatggtgtcatttgatcctatc |
24433421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 27059225 - 27059178
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27059225 |
atttggtgtgaaactaattttgacaccatggtgtcatttgatcctatc |
27059178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38986039 - 38985992
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
38986039 |
atttggtgtcaaactaattttgacaccatagtgtcatttgatcctatc |
38985992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 2868667 - 2868709
Alignment:
| Q |
6 |
gtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2868667 |
gtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
2868709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 19911137 - 19911178
Alignment:
| Q |
5 |
ggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19911137 |
ggtgtcaaactaattttgacaccatggtgtcatttgatccta |
19911178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 37875440 - 37875395
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37875440 |
atttcgtgtcaaactaattttgacaccatggtgtcatttgatccta |
37875395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 27060019 - 27060066
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
27060019 |
atttggtgtcaaactaattttgacactatggtatcatttgatcctatc |
27060066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 8911843 - 8911890
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
8911843 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
8911890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 8911215 - 8911166
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatctc |
50 |
Q |
| |
|
||||||||||||| | |||||||||||||||| ||||||||||||||| |
|
|
| T |
8911215 |
atttggtgtcaaatataatttgacaccatggtgtcatttgatcctatctc |
8911166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 38986857 - 38986898
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgat |
42 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
38986857 |
atttggtgtcaaactaattttgataccatgatgtcatttgat |
38986898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20203306 - 20203354
Alignment:
| Q |
1 |
atttggtgtcaaact-aattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | || |||||||||||||||| ||||||||||||| |
|
|
| T |
20203306 |
atttggtgtcaaatttaaatttgacaccatggtgtcatttgatcctatc |
20203354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 19)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4594755 - 4594708
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4594755 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
4594708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 4595582 - 4595629
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4595582 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
4595629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 40959778 - 40959825
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40959778 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
40959825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 48577562 - 48577609
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48577562 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatcctatc |
48577609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 23174046 - 23174091
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23174046 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
23174091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 23601785 - 23601740
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23601785 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
23601740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 48644837 - 48644882
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48644837 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
48644882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 51661363 - 51661408
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51661363 |
atttggtgtcaaactaattttgacaccatggtgtcatttgatccta |
51661408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24081503 - 24081456
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
24081503 |
atttggtgtcaaattaattttgacaccatggtgtcatttgatcctatc |
24081456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 31150727 - 31150680
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
31150727 |
atttggtgtcaaactaattttgacaccattgtgtcatttgatcctatc |
31150680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 31151440 - 31151487
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
31151440 |
atttggtgtcaaactaattttgataccatggtgtcatttgatcctatc |
31151487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 40958936 - 40958889
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
40958936 |
atttggtgtcaaactaattttgacaccatggtatcatttgatcctatc |
40958889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 39870112 - 39870067
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatccta |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
39870112 |
atttggtgtcaaactaattttgacaccatggcgtcatttgatccta |
39870067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 39870817 - 39870866
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatctc |
50 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
39870817 |
atttggtgtcaaactaaatttgacaccatggtgtcatttgatcatatctc |
39870866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 24082203 - 24082250
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| ||||||||||||| |
|
|
| T |
24082203 |
atttggtgtcaaactaattttgataccatgatgtcatttgatcctatc |
24082250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 23173333 - 23173287
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctat |
47 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
23173333 |
atttagtgtcaaactaattttgacaccatgatgtcatttgatcctat |
23173287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 51660653 - 51660605
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatg-gtgttatttgatcctatc |
48 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
51660653 |
atttggtgacaaactaattttgacaccatgtgtgtcatttgatcctatc |
51660605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 14886836 - 14886883
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
14886836 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
14886883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 21791488 - 21791535
Alignment:
| Q |
1 |
atttggtgtcaaactaattttgacaccatggtgttatttgatcctatc |
48 |
Q |
| |
|
||||||||||||| | | |||||||||||||||| ||||||||||||| |
|
|
| T |
21791488 |
atttggtgtcaaatttaatttgacaccatggtgtcatttgatcctatc |
21791535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University