View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11561_high_24 (Length: 201)
Name: NF11561_high_24
Description: NF11561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11561_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 70 - 192
Target Start/End: Complemental strand, 38879426 - 38879305
Alignment:
| Q |
70 |
ctcttcattgtgtgtgagcctccagcatgggtatgaccgtcatgagtctaagaaaaattaagatgacattaaaaatcataaacgtgcgtgcgcgcgcgtt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| || ||||||||||||||| | ||| ||| ||||| ||| |
|
|
| T |
38879426 |
ctcttcattgtgtgtgagcctccagcatgggtatgaccgacatgagtctaacaaaaattaaaat-acattaaaaatcatatatgtgtgtgtgcgcgtgtt |
38879328 |
T |
|
| Q |
170 |
tgagtgtgtgtaggtgtctgtgc |
192 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
38879327 |
tgagtgtgtgtgggtgtctgtgc |
38879305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University