View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11561_low_11 (Length: 417)
Name: NF11561_low_11
Description: NF11561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11561_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 60 - 394
Target Start/End: Complemental strand, 7920938 - 7920604
Alignment:
| Q |
60 |
gatattgtgtaggcagtccaaagataaaattaatacaactctctttttccatgctaaacnnnnnnnnagtcaaatcaatacggtacacgtcccacctctt |
159 |
Q |
| |
|
|||||||| |||||||||||| || ||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
7920938 |
gatattgtataggcagtccaa-gaaaaaattaatacaagtctctttttccatgctaaacatttttttagtcaagtcaatacggtacacgtcccacctctt |
7920840 |
T |
|
| Q |
160 |
attaaatgagatagtagttaccatatcataacaggttcatcttgttctcatttcacaccaaccccc-ttgcttatattcctgcttgctttgactcagaat |
258 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7920839 |
attaaacgagatagtagttaccatatcataccaggttcatcttgttctcatttcacaccaaccccccttgcttatattcctgcttgctttgactcagaat |
7920740 |
T |
|
| Q |
259 |
ctttcattggcagctatggcggttaacgatgatcctatggtggttcccactctctctccgcccaacacctacgaagccgtcgtcaatggtggcaccttcg |
358 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7920739 |
cttacattggcagctatggcggttaacgatgatcctatggtggttcccactctctctccgcccaacacctacgaagccgtcgtcaatggtggcaccttcg |
7920640 |
T |
|
| Q |
359 |
accgattgcatgacggccatcgcctctttctcactg |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7920639 |
accgattgcatgacggccatcgcctctttctcactg |
7920604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 94; Significance: 9e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 270 - 394
Target Start/End: Original strand, 31236109 - 31236236
Alignment:
| Q |
270 |
agctatggcggttaacgatgatcctatggtggttccc---actctctctccgcccaacacctacgaagccgtcgtcaatggtggcaccttcgaccgattg |
366 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31236109 |
agctatgactgttaacgatgatcctatggtggttccccccactctctctccccccaacacctacgaagccgttgtcaatggtggcaccttcgaccgattg |
31236208 |
T |
|
| Q |
367 |
catgacggccatcgcctctttctcactg |
394 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
31236209 |
catgacggccatcgcctttttctcactg |
31236236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University