View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11561_low_21 (Length: 250)
Name: NF11561_low_21
Description: NF11561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11561_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 7624236 - 7624475
Alignment:
| Q |
1 |
ctagctaatgcaatgaaccatagagacatggttaatttatgttatgtatgtggctatggttatgaaatatgaaatatatgtgatgatgattaaggattaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624236 |
ctagctattgcaatgaaccatagagacatggttaatttatgttatgtatgtggctatggttatgaaatatgaaatatatgtgatgatgattaaggattaa |
7624335 |
T |
|
| Q |
101 |
ggatataaataagttttgtacgtataacaacagcaatctatttgaatagggaaaaacaaattaactacttgacgttgtattgttgtcacattgagctaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624336 |
ggatataaataagttttgtacgtataacaacagcaatctatttgaatagggaaaaacaaattaactacttgacgttgtattgttgtcacattgagctaag |
7624435 |
T |
|
| Q |
201 |
cctcaacatgcttggtatttatagaggaaacgtttctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624436 |
cctcaacatgcttggtatttatagaggaaacgtttctctg |
7624475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 7659449 - 7659415
Alignment:
| Q |
1 |
ctagctaatgcaatgaaccatagagacatggttaa |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7659449 |
ctagctaatgcaatgaaccatagagacatggttaa |
7659415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 237
Target Start/End: Complemental strand, 7659350 - 7659294
Alignment:
| Q |
180 |
ttgttgtcacattgagctaagcctcaacatgcttggtatttatagaggaaacgtttct |
237 |
Q |
| |
|
|||||||| |||| ||||| ||||||| |||||||||||||||| ||||| ||||||| |
|
|
| T |
7659350 |
ttgttgtctcattaagctatgcctcaatatgcttggtatttata-aggaatcgtttct |
7659294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University