View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11563_high_11 (Length: 242)
Name: NF11563_high_11
Description: NF11563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11563_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 37306345 - 37306148
Alignment:
| Q |
11 |
aataaacatttagtttgtggttatttaaaaaggttatttcagcttatctctcttatagtgacattatatatatcccgtggtgaaagtctcttatctcctc |
110 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
37306345 |
aataaacatttactttctggttatttaaaaaagttatttcagcttatctctcttaatgtgacattatat----cccgtggtgaa---------tctcctc |
37306259 |
T |
|
| Q |
111 |
ataactatgttgtaggatttgtgtagagtaacaaataaattagtttatcgtattgttagagcattatgttgcttgccttctcatagtttatagaattgtc |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37306258 |
ataactatgttgtaggatttgtctagagtaacaaataaattagtttatcgtattgttagagcattatgttgcttgccttctcatagtttatagtattgtc |
37306159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University