View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11563_low_15 (Length: 220)
Name: NF11563_low_15
Description: NF11563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11563_low_15 |
 |  |
|
| [»] chr7 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 37306998 - 37306782
Alignment:
| Q |
1 |
ctctccttatttccttcttattcatatccctggctacagccaccgattactacaaaagcttatctccagctttgttgggttttcaagaagagaaattcac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306998 |
ctctccttatttccttctt---catatccctggctacagccaccaattactacaaaagcttatctccagctttgttgggttttcaagaagagaaattcac |
37306902 |
T |
 |
| Q |
101 |
ccaccttcacttctatttccatgacgttatggaaggccccaaagcaagaacagtgatagtagccgagcccaacggcaaggctgaaaactctcttccattc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306901 |
ccaccttcacttctatttccacgacgttatggaaggccccaaagcaagcacagtgatagtagccgagcccaacggcaaggctgaaaactctcttccattc |
37306802 |
T |
 |
| Q |
201 |
ggaacagtggtggccatgga |
220 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
37306801 |
gggacagtggtggccatgga |
37306782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 112
Target Start/End: Complemental strand, 37317274 - 37317235
Alignment:
| Q |
73 |
tgttgggttttcaagaagagaaattcacccaccttcactt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37317274 |
tgttgggttttcaagaagagaaattcactcaccttcactt |
37317235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 125
Target Start/End: Complemental strand, 37324861 - 37324782
Alignment:
| Q |
46 |
attactacaaaagcttatctccagctttgttgggttttcaagaagagaaattcacccaccttcacttctatttccatgac |
125 |
Q |
| |
|
||||||| ||||| |||||||| | || ||||||||||||||||||||||||| ||||||||||| || || |||||| |
|
|
| T |
37324861 |
attactatcaaagcctatctccaacaatgctgggttttcaagaagagaaattcactcaccttcacttttactttcatgac |
37324782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 37320902 - 37320817
Alignment:
| Q |
24 |
atatccctggctacagccaccgattactacaaaagcttatctccagctttgttgggttttcaagaagagaaattcacccaccttca |
109 |
Q |
| |
|
|||||||| || || ||||| ||||||| |||||| |||| ||| | || ||||||||||||||||||||||||| |||||||| |
|
|
| T |
37320902 |
atatcccttgccactgccactaattactataaaagcctatccccaacaatgctgggttttcaagaagagaaattcactcaccttca |
37320817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University