View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11563_low_16 (Length: 213)
Name: NF11563_low_16
Description: NF11563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11563_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 26782999 - 26782795
Alignment:
| Q |
1 |
tggtatactagagactagtagagtgaatgaatggattgtcacagaaaaacttggaaatgctcttgaggaccaagatagtaaaggacttgaaaagcttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26782999 |
tggtatactagagactagtagagtgaatgaatggattgtcacagaaaaacttggaaatgctcttaaggaccaagatagtaaaggacttgaaaagcttcaa |
26782900 |
T |
|
| Q |
101 |
tttaagattggaaacaggt---nnnnnnnnggtcaatgtatttgttgtatagactttttgcttacatttaaaattagagaccgattacaaaaatatatta |
197 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26782899 |
tttaagattggaaacaggtaaaaaaaaaaaggtcaatgtatttgttgtatagactttttgcttacatttaaaattagagaccgattaaaaaaatatatta |
26782800 |
T |
|
| Q |
198 |
gagag |
202 |
Q |
| |
|
||||| |
|
|
| T |
26782799 |
gagag |
26782795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 26816202 - 26816140
Alignment:
| Q |
1 |
tggtatactagagactagtagagtgaatgaatggattgtcacagaaaaacttggaaatgctct |
63 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
26816202 |
tggtctactagagactagtagagtgaatgaatggattgtcactgaaaaacttggagatgctct |
26816140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 26789365 - 26789310
Alignment:
| Q |
8 |
ctagagactagtagagtgaatgaatggattgtcacagaaaaacttggaaatgctct |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
26789365 |
ctagagactagtagagtgaatgaatggattgtcactgaaaaacttggagatgctct |
26789310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 26829888 - 26829828
Alignment:
| Q |
1 |
tggtatactagagactagtagagtgaatgaatggattgtcacagaaaaacttggaaatgct |
61 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
26829888 |
tggtctactagaggctagtagagtgaatgaatggattgtcactgaaaaacttggagatgct |
26829828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 41920862 - 41920924
Alignment:
| Q |
1 |
tggtatactagagactagtagagtgaatgaatggattgtcacagaaaaacttggaaatgctct |
63 |
Q |
| |
|
|||| |||| ||| ||||| |||||||||||||||||||||| || ||||||||| ||||||| |
|
|
| T |
41920862 |
tggtctactggaggctagtcgagtgaatgaatggattgtcactgagaaacttggagatgctct |
41920924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 22 - 64
Target Start/End: Original strand, 2301218 - 2301260
Alignment:
| Q |
22 |
agtgaatgaatggattgtcacagaaaaacttggaaatgctctt |
64 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2301218 |
agtgaatgaatggattgtcactaaaaaacttggaaatgctctt |
2301260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University