View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11563_low_7 (Length: 357)
Name: NF11563_low_7
Description: NF11563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11563_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 17 - 351
Target Start/End: Complemental strand, 2222382 - 2222048
Alignment:
| Q |
17 |
aggtttaatctcactcagaaaaatcacaagaacgaatttggaaagtagagttcaactttgcaccaatagggtactatgttttctgcgttctttgattttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222382 |
aggtttaatctcactcagaaaaatcacaagaacgaatttggaaagtagagttcaactttgcagcaatagggtactatgttttctgcgttctttgattttg |
2222283 |
T |
 |
| Q |
117 |
tctaagaacgaggttgtaagagtcaatgcacttgcttcattggtcaacctttcacttgagaaagttaacaaagtgaagatagtccggtcaggaattgttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222282 |
tctaagaacgaggttgtaagagtcaatgcacttgcttcattggtcaacctttcacttgagaaagttaacaaagtgaagatagtccggtcaggaattgttc |
2222183 |
T |
 |
| Q |
217 |
caccgttgattgaggttttgaggtttgggtcgtgtgaatcgcaggaacatgcttcgtgtgcgatgtttagtttagcgcttgatgatgataataaaactgc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222182 |
caccgttgattgaggttttgaggtttggatcgtgtgaatcgcaggaacatgcttcgtgtgcgatgtttagtttagcgcttgatgatgataataaaactgc |
2222083 |
T |
 |
| Q |
317 |
gattggtgttttaggtgctcttttgcctttgcttc |
351 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2222082 |
gattggtgttttaggtgctcttttgccattgcttc |
2222048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 335
Target Start/End: Complemental strand, 35294456 - 35294371
Alignment:
| Q |
250 |
gtgaatcgcaggaacatgcttcgtgtgcgatgtttagtttagcgcttgatgatgataataaaactgcgattggtgttttaggtgct |
335 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||| || | |||||||||||||| | || ||||||||| | |||||| |
|
|
| T |
35294456 |
gtgaatcgcaggaacatgctgcgggtgcgttgtttagtttggctttggatgatgataataagatggcaattggtgttcttggtgct |
35294371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University