View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11563_low_8 (Length: 321)
Name: NF11563_low_8
Description: NF11563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11563_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 85 - 305
Target Start/End: Complemental strand, 1807129 - 1806909
Alignment:
| Q |
85 |
atcagtaattagtaactttcatttgtcattaaaactatgagtggttatgggttcgatctcgtctcttatgtaagaaaaaacatcagtttgnnnnnnngaa |
184 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||| |
|
|
| T |
1807129 |
atcaataattagtaactttcatttgtcattaaaactatgagtggttatgggttcgatctcgtctcttatgtaaggaaaaacatcggtttgaaaagaagaa |
1807030 |
T |
|
| Q |
185 |
tctactttgtgtgctacataagttttttgagtgaagattagtttacgttaaatagggatgcaatttttgtttctctaatatgtgaagattagatgatgag |
284 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1807029 |
tctactttgtgtgttacataagttttttgagtgaagattagtttacgttaaatagcgatgcaattttagtttctctaatatgtgaagattagatgatgag |
1806930 |
T |
|
| Q |
285 |
tggtagttgagtgtgtgtttt |
305 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1806929 |
tggtagttgagtgtgtgtttt |
1806909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 25 - 64
Target Start/End: Complemental strand, 1807189 - 1807150
Alignment:
| Q |
25 |
gtgtttcttgtttgatgaatgatgggatgaagtgtgagga |
64 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1807189 |
gtgtttgttgtttgatgaatgatgggatgaagtgtgagga |
1807150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University