View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11564_high_32 (Length: 215)
Name: NF11564_high_32
Description: NF11564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11564_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 43636593 - 43636772
Alignment:
| Q |
20 |
ttcataaaatattgtttggcctatagcgcatgggtaaatgtaccaaatcatggttcagaataaatactcaaccactgacaaccttgaagaacaaggccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43636593 |
ttcataaaatattgtttggcctatagtgcatgggtaaatgtaccaaatcatggttcagaataaatactcaaccactgacaaccttgaagaacaaggccaa |
43636692 |
T |
 |
| Q |
120 |
gggacatggagcattaccatgctatcatcataatcaaatttcacagcttctccgtcaatcatacaacttaccggcttctc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43636693 |
gggacatggagcattaccatgctatcatcataatcaaatttcacagcttctccgtcaatcatacaacttaccggcttctc |
43636772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University