View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11564_low_14 (Length: 414)
Name: NF11564_low_14
Description: NF11564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11564_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 5e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 190 - 350
Target Start/End: Original strand, 19397807 - 19397967
Alignment:
| Q |
190 |
ttcataatttactttacatttttcataacactctactattaacttttcaagtaacaaatcttcacttttaccataatcgaactctcactttgttcctgtt |
289 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19397807 |
ttcataatttactttacatttctcataacactctactattaacttttcaagtaagaactcttcacttttaccataatcgaactctcactttgttcctgtt |
19397906 |
T |
 |
| Q |
290 |
ttatttattttacatttctataccaggtttttgttaatttgttgtgttgtcctgagttcgc |
350 |
Q |
| |
|
| |||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
19397907 |
tcattttttttacatttctataccagatttttgttaatttgttgtgttgtcttgagttcgc |
19397967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 33 - 105
Target Start/End: Original strand, 19397651 - 19397722
Alignment:
| Q |
33 |
gtaaatagtttgtcttttgtatagctcaagaaaaaggcaggtacctttccactcttctcaacatttgtcatca |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
19397651 |
gtaaatagtt-gtcttttgtatagctcaagaaaaaggcaggtaccttttcactcttctcaacatttttcatca |
19397722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University