View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11564_low_24 (Length: 297)
Name: NF11564_low_24
Description: NF11564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11564_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 7 - 281
Target Start/End: Complemental strand, 43282078 - 43281805
Alignment:
| Q |
7 |
gaagcaaaggacccatggggtttgtattttagtacagatttaggtgtattattttttggtggttggaaatgttaatatcttaaaattatcaatgaaagtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43282078 |
gaagcaaaggacccatggggtttgtattttagtacagatttaggtgtattattttttggtggttggaaatgttaatatcttaaaattatcaatgaaagtg |
43281979 |
T |
 |
| Q |
107 |
tagtgtatagttttagtatttctgaaggaaaaaatagctggatcctttgggagaacagtgtgattaacagaagttatggggtgtactttttgtgttacga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43281978 |
tagtgtatagttttagtatttctgaaggaaaaaatagctggatcctttgggagaacagtgtgattaacagaagttatggggtgtactttttgtgttacga |
43281879 |
T |
 |
| Q |
207 |
gcaattttttaacatgttagtagtactatatgctaagctttattgttgc--tacttgctatgcttcggagaaaacat |
281 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43281878 |
gcaattttttaacatgttagtag---tatatgctaagctttattgttgctatacttgctatgcttcggagaaaacat |
43281805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University