View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11564_low_31 (Length: 240)
Name: NF11564_low_31
Description: NF11564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11564_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 32982275 - 32982485
Alignment:
| Q |
12 |
aagcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982275 |
aagcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataa |
32982374 |
T |
 |
| Q |
112 |
atcttcactacttctatactccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatcc |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32982375 |
atcttcactacttctatactccacagtgtccacaacattcatatcagcctcagctgtggttgtctcagtcaccaattgtacagttttctttgttgcatcc |
32982474 |
T |
 |
| Q |
212 |
catgcagtttc |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
32982475 |
catgcagtttc |
32982485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 129 - 222
Target Start/End: Original strand, 27037952 - 27038045
Alignment:
| Q |
129 |
actccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatcccatgcagtttc |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
27037952 |
actccgcagtgtccacggcattcatatcagcctcagcagtggttgtctctgtcaccaattgtacagtgttctttgtagcatcccatgcagtttc |
27038045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University