View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11565_high_28 (Length: 249)
Name: NF11565_high_28
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11565_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 132 - 240
Target Start/End: Complemental strand, 50974463 - 50974355
Alignment:
| Q |
132 |
gggatggtggaataaccacacaacttggcaccgcctttaaaatgtggtcgtaatcgttgtaactgcttcaacgaaaacagctccaacaaagatcatttgc |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
50974463 |
gggatggtggaataaccacacaacttgacaccgcctctaaaacgtggtcgtaatcgttgtaactgcttcaaggaaaacagctccaacaaagaccatttgc |
50974364 |
T |
|
| Q |
232 |
atctctctg |
240 |
Q |
| |
|
||||||||| |
|
|
| T |
50974363 |
atctctctg |
50974355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 132 - 237
Target Start/End: Complemental strand, 26839368 - 26839263
Alignment:
| Q |
132 |
gggatggtggaataaccacacaacttggcaccgcctttaaaatgtggtcgtaatcgttgtaactgcttcaacgaaaacagctccaacaaagatcatttgc |
231 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
26839368 |
gggatggtggaataaccaaacaacttgacaccgcctctaaaatgtggtcgtaatcgctgtaactgcttcaacaaaaacagctccaacaaagaccatttgc |
26839269 |
T |
|
| Q |
232 |
atctct |
237 |
Q |
| |
|
|||||| |
|
|
| T |
26839268 |
atctct |
26839263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University