View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11565_low_21 (Length: 292)
Name: NF11565_low_21
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11565_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 273
Target Start/End: Original strand, 48449451 - 48449706
Alignment:
| Q |
18 |
aaaacttaacatgtttgaagctttgtggtctgatatgaagtttttgattcacagaaatccaatatagtggaggatcttgctgacttgcacaacaatcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48449451 |
aaaacttaacatgtttgaagctttgtggtctgatatgaagtttttgattcacagaaatccaatatagtggagtatcttgctgacttgcacaacaatcaaa |
48449550 |
T |
 |
| Q |
118 |
agctatggcctacacagcagttggcatacctacctctccaacaacgtcttcaactaaggacattacaaaagaacgttatggtcttcgccgctcacgctcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48449551 |
agctatggcctacacagcagttggcatacctacctctccaacaacgtcttcaactaaggacattacaaaagaacgttatggtcttcgccgctcgcgctcc |
48449650 |
T |
 |
| Q |
218 |
agcatagacctatgtagacgttccattatgcagaggtcttattctgacagctatct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48449651 |
agcatagacctatgtagacgttccattatgcagaggtcttattctgacagctatct |
48449706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University