View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11565_low_26 (Length: 259)
Name: NF11565_low_26
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11565_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 26414196 - 26413952
Alignment:
| Q |
1 |
tgaaattttaatcatcatatttgtcaaacatgtgaatactttctatgccttttgcaacaacatttgaactagtatacatatgtagcacaacaaaacaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414196 |
tgaaattttaatcatcatatttgtcaaacatgtgaatactttctatgccttttgcaacaacatttgaactagtatacatatgtagcacaacaaaacaaaa |
26414097 |
T |
 |
| Q |
101 |
ccagagaggactggtataaattaaattaatttggcttcttcatgacatgctataaattgatttggtacttatggttagaaagtcggtgaggaaggggagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26414096 |
ccagagaggactggtataaattaaattaatttggcttcttcatgacatgctataaattgatttggtacttatggttagaaagtcggtgaggaagggaagg |
26413997 |
T |
 |
| Q |
201 |
ggagaagatagtatatggcacggttcattaatgttatgtgtctgt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26413996 |
ggagaagatagtatatggcacggttcattaatgttatgtgtctgt |
26413952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University