View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11565_low_32 (Length: 247)
Name: NF11565_low_32
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11565_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 2096796 - 2097026
Alignment:
| Q |
1 |
aattgtgccatcataatcaacaccattaaaggtgtaaactgatcccttgacacaatgaacttctaatcgatcgttacaatactcacattccctgcatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096796 |
aattgtgccatcataatcaacaccattaaaggtgtaaactgatcccttgacacaatgaacttcgaatcgatcgttacaatactcacattccctgcatgag |
2096895 |
T |
|
| Q |
101 |
ttgatgtaagtccccactccgacatggtcaccaaccttgaaacgctggacattgggaccaacctttgccacaaccccagcaatctcgtgtctgataagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096896 |
ttgatgtaagtccccactccgacatggtcaccaaccttgaaacgctggacattgggaccaacctttgccacaaccccagcaatctcgtgtctgataagaa |
2096995 |
T |
|
| Q |
201 |
aaaaggaaaacacagataaataaactgatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
2096996 |
aaaaggaaaacacagataaataaacttatgt |
2097026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 2102981 - 2103039
Alignment:
| Q |
1 |
aattgtgccatcataatcaacaccattaaaggtgtaaactgatcccttgacacaatgaa |
59 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2102981 |
aattgtaccatcataatcaacacaattaaaggtgtaaactgatcccttggcacaatgaa |
2103039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University