View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11565_low_35 (Length: 239)
Name: NF11565_low_35
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11565_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 5232589 - 5232371
Alignment:
| Q |
1 |
agattcatatgaattgcattctctgattgaaggcgtgtctggtgtcaacacgtgtcggtgtccaacaccaacatgatactgacacatgtgagtacgatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5232589 |
agattcatatgaattgcattctctgattgaaggcgtgt---gtgtcaacacgtgtcggtgtccaacaccaacatgatactgatacatgtgagtacgatca |
5232493 |
T |
|
| Q |
101 |
aatatttcnnnnnnnnncaaattattactggtgttgaagtgtcagtgtcgtgtctgatgtctgtatctatgtttcatacatcgttcaatttagtattgaa |
200 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5232492 |
aatatttcattttttt-caaattattactg-tgttgaagtgtcagtgtcgtgtctgatgtctatatctatgtttcatagatcgttcaatttagtattgaa |
5232395 |
T |
|
| Q |
201 |
tcgagataaacttctatccatatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5232394 |
tcgagataaacttctatccatatt |
5232371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 158
Target Start/End: Complemental strand, 12054349 - 12054309
Alignment:
| Q |
118 |
caaattattactggtgttgaagtgtcagtgtcgtgtctgat |
158 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
12054349 |
caaattattactgctgttgacgtgtcagtgtcgtgtttgat |
12054309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University