View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11565_low_36 (Length: 239)
Name: NF11565_low_36
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11565_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 43860571 - 43860351
Alignment:
| Q |
1 |
cccggcacctttccataacatcacacagctcagacaaatctttgctaataaaaagcttactcttcatgacttggttgtattatcaggtacgtttaattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43860571 |
cccggcacctttccataacatcacacagctcagacaaatctttgctaataaaaagcttactcttcatgacttggttgtattatcaggtacatttaattaa |
43860472 |
T |
 |
| Q |
101 |
gtctgttttcnnnnnnnntccatgttaaaaataaacattatgcata---acttgattaccaagctacttaaaatatagtctaagccatgctaattaacca |
197 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43860471 |
gtctgttttc-aaaaaaatccatgttaaaaataaacattatgcataaatacttgattaccaagctacttaaaatatagtctaagccatgctaataaacca |
43860373 |
T |
 |
| Q |
198 |
atttaaactatatagtaccaac |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43860372 |
atttaaactatatagtaccaac |
43860351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University