View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11565_low_38 (Length: 238)

Name: NF11565_low_38
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11565_low_38
NF11565_low_38
[»] chr3 (1 HSPs)
chr3 (72-222)||(10469020-10469172)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 72 - 222
Target Start/End: Original strand, 10469020 - 10469172
Alignment:
72 taattgaagatatgattaaagag--tcacaacagaacgaaacacataacaaaatcgttttaacggctgaaaacgacatgaaaagaatttgcacttacaat 169  Q
    |||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10469020 taattgaagatatgattaaagagagtcacaacagaacgcaacacataacaaaatcgttttaacggctgaaaacgacatgaaaagaatttgcacttacaat 10469119  T
170 gacggtttcgttactttgttgccatcatcattggcttcttcatcatcttcttc 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
10469120 gacggtttcgttactttgttgccatcatcattggcttcttcatcatcttcttc 10469172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University