View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11565_low_40 (Length: 222)
Name: NF11565_low_40
Description: NF11565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11565_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 48892240 - 48892039
Alignment:
| Q |
1 |
caaaagagagagacagtgatgggtttggattgttgtttgaggaacagtaccatgcagacttggtcaacaatgatgacattgaatgccaatctggttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48892240 |
caaaagagagagacagtgatgggtttggattgttgtttgaggaacagtaccatgcagacttggtcaacaatgatgacattgaatgccaatctggttttct |
48892141 |
T |
|
| Q |
101 |
tgagaagatgtatgaagagtacttgcagctattgaagaatgaagaaaatcatgaaaaaatactagattcttttgctcagtccttattagcgtgagtaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48892140 |
tgagaagatgtatgaagagtacttgcagctattgaagaatgaagaaaatcatgaaaaaatactagattcttttgctcagtccttattagcgtgagtaata |
48892041 |
T |
|
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
48892040 |
at |
48892039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University