View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11566_high_10 (Length: 340)
Name: NF11566_high_10
Description: NF11566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11566_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 99 - 328
Target Start/End: Complemental strand, 52273563 - 52273334
Alignment:
| Q |
99 |
ggcagtgacgacgataacggcagtgagaagaagcttaaagaatctatctccaataaaagaaaagccgagaaggtttgtatgcgttttccagtgaattctt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52273563 |
ggcagtgacgacgataacggcagtgagaagaagcttaaagaatctatctccaataaaagaaaagccgagaaggtttgtatgcgttttccagtgaattatt |
52273464 |
T |
|
| Q |
199 |
tttatacaatttgttattgattttattaatttgtagattcaccgatttaacaggaaagaagggaaaatctcaaacagcttcgagctgagtctcagagact |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52273463 |
tttatacaatttgttattgattttattaatttgtagattcaccgatttaacaggaaagaagggaaaatctcaaacagcttcgagctgagtctcagagact |
52273364 |
T |
|
| Q |
299 |
tcttcgcggtatggatatattttggatttt |
328 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
52273363 |
tcttcgcggtatggatattttttggatttt |
52273334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University